Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmg0001

[Submit comment/correction]

Locus	Bmg0001
Type	Microsatellite
Chromosome	6H
Map	Barley-ConsensusFHB-6H 63 Hordeum-Consensus2007-SSR-6H 64.71 Hordeum-LxHs-6H 104 Hv-Integrated2009-6H 70.9
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, Integrated, Marcel 2009 Barley, LxHs
Species	Hordeum vulgare
Probe	BMG001 Bmg1
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' [ Show all 6 ]
Probe for Locus	BMG001
Locus	Bmg0001
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Type	SSR
PCR primers	GTGTGGTGTTAGCAAGGGGT TCACAGGGCACACACACAC