Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: DGF15

[Submit comment/correction]

Locus	DGF15
Type	RFLP
Chromosome	2A 2B 2D 2H
Chromosome Arm	2AL 2DL 2HL
Map	Barley-Consensus-2H 54.5 Barley-Consensus2-2H 108.7
	[ Show Nearby Loci ]
Map Data	Barley consensus Barley consensus 2 Wheat chromosome arm map
Probe	DGF15 pTtksuF15
Possible Orthologs	DGF15B
Probe for Locus	pTtksuF15
Locus	ksuF15A [ Show all 8 ]
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type	Genomic STS
PCR primers	R:AAGGTGGAAGTATGGTGCTA L:AAGAAGAGGAGAAAACAGAC
Polymorphism	KSUF15 EcoRI
Linkage Group	2D 2
Insert Enzyme	PstI
Source Species	Triticum tauschii
Insert Size	0.8