Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: F015

[Submit comment/correction]

Locus	F015
Type	RFLP
Map	Tt-Gill-2D 34.3
	[ Show Nearby Loci ]
Map Data	T.tauschii
Probe	pTtksuF15
Possible Orthologs	ksuF15 [ Show all 6 ]
Probe for Locus	pTtksuF15
Locus	ksuF15A [ Show all 8 ]
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type	Genomic STS
PCR primers	R:AAGGTGGAAGTATGGTGCTA L:AAGAAGAGGAGAAAACAGAC
Polymorphism	KSUF15 EcoRI
Linkage Group	2D 2
Insert Enzyme	PstI
Source Species	Triticum tauschii
Insert Size	0.8