Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: GBM1107

[Submit comment/correction]

Locus	GBM1107
Type	Microsatellite
Map	Hv-Integrated2009-4H 21.4
	[ Show Nearby Loci ]
Map Data	Barley, Integrated, Marcel 2009
Probe	GBM1107
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys
Probe	GBM1107
Locus	GBM1107 GBM1107-4H
Reference	Varshney RK et al. (2006) Genetic mapping and BAC assignment of EST-derived SSR markers shows non-uniform distribution of genes in the barley genome Theoretical and Applied Genetics 113:239-250.
Remarks	Clone HI01F16T
PCR primers	CTCCTCAGCTACGACGACCT ACACGAGCTGGAAGTGTCCT
Amplification Conditions	3 min at 94 deg C; 45 cycles with 30 sec at 94 deg C, 30 sec at 60 deg C (touchdown of 0.5 deg C / cycle for initial 10 cycles - final annealing of 55 deg C for remaining 35 cycles), 30 sec at 72 deg C; and a final extension step of 5 min at 72 deg C
Sequence	BQ462579
DNA Library	IPK-HI
Source Species	Hordeum vulgare
Source Germplasm	Barke (barley)