Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: GBM1215

[Submit comment/correction]

Locus	GBM1215
Type	Microsatellite
Chromosome	6H
Map	Barley, B73xCPI-6H 36.7 Barley-ConsensusFHB-6H 41.3 Hordeum-Consensus2006-DArT-6H 47.8 Hordeum-Consensus2007-SSR-6H 39.54 Hv-Integrated2009-6H 39.6
	[ Show Nearby Loci ]
Map Data	Barley, B73xCPI Barley, Consensus 2006, DArT Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, Integrated, Marcel 2009
Species	Hordeum vulgare
Probe	GBM1215
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Varshney RK et al. (2006) Genetic mapping and BAC assignment of EST-derived SSR markers shows non-uniform distribution of genes in the barley genome Theoretical and Applied Genetics 113:239-250.
Remark	Number of populations contributing to the placement of GBM1215 in the Barley, Consensus 2006 DArT maps = 1 [ Show all 7 ]
Probe	GBM1215
Locus	GBM1215 GBM1215-6H
Reference	Hayden MJ et al. (2008) Multiplex-Ready PCR: A new method for multiplexed SSR and SNP genotyping BMC Genomics 9:80. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Varshney RK et al. (2006) Genetic mapping and BAC assignment of EST-derived SSR markers shows non-uniform distribution of genes in the barley genome Theoretical and Applied Genetics 113:239-250.
Remarks	Clone HS04I19u
Type	SSR
PCR primers	ATGACCAGAAAACGCCTGTC GGATTCTGCACACACGAGAA Forward ATGACCAGAAAACGCCTGTC Reverse GGATTCTGCACACACGAGAA
Amplification Conditions	3 min at 94 deg C; 45 cycles with 30 sec at 94 deg C, 30 sec at 60 deg C (touchdown of 0.5 deg C / cycle for initial 10 cycles - final annealing of 55 deg C for remaining 35 cycles), 30 sec at 72 deg C; and a final extension step of 5 min at 72 deg C
Sequence	BQ662872
DNA Library	IPK-HS
Source Species	Hordeum vulgare
Source Germplasm	Barke (barley)