Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: GBM1382-3H

[Submit comment/correction]

Locus	GBM1382-3H
Type	Microsatellite
Map	Hv-Consensus2006-Stein-3H 27.1 Hv-SxM-Stein-3H 11.13
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2006, Stein Barley, SxM, Stein2006
Probe	GBM1382
Probe for Locus	GBM1382
Locus	GBM1382 GBM1382-3H
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Varshney RK et al. (2006) Genetic mapping and BAC assignment of EST-derived SSR markers shows non-uniform distribution of genes in the barley genome Theoretical and Applied Genetics 113:239-250.
General Remarks	Clone HM02B09u
Type	SSR
PCR primers	TCTCAACTCACATGGCTTGG GATTGATGGATTGATTGCCC
Amplification Conditions	3 min at 94 deg C; 45 cycles with 30 sec at 94 deg C, 30 sec at 60 deg C (touchdown of 0.5 deg C / cycle for initial 10 cycles - final annealing of 55 deg C for remaining 35 cycles), 30 sec at 72 deg C; and a final extension step of 5 min at 72 deg C
Sequence	BQ661133
DNA Library	IPK-HM
Source Species	Hordeum vulgare
Source Germplasm	Barke (barley)