Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: GBM1487

[Submit comment/correction]

Locus	GBM1487
Type	Microsatellite
Chromosome	1H
Map	Barley-ConsensusFHB-1H 60.2 Hordeum-Consensus2007-SSR-1H 60.42 Hv-Consensus2006-Marcel-1H 60.42 Hv-Integrated2009-1H 61.2 Hv-L94/Vada-2006-1H 56.11
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2006, Marcel Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, Integrated, Marcel 2009 Barley, L94 x Vada, 2006
Species	Hordeum vulgare
Probe	GBM1487
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Marcel TC et al. (2007) A high-density consensus map of barley to compare the distribution of QTLs for partial resistance to Puccinia hordei and of defence gene homologues. Theoretical and Applied Genetics 114:487-500.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' [ Show all 7 ]
Probe	GBM1487
Locus	GBM1487
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
Remarks	Primer sequences for this SSR to be released in the public domain soon (noted: September 2006). Those interested should contact Andreas Graner
Type	SSR
PCR primers	ACGAGGGAATTGAAGCGAG GTCCATTTCCTCCATCATGC
Source Species	Hordeum vulgare