Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: GBS0125

Locus	GBS0125
Type	SNP
Map	Hv-Integrated2009-1H 65.4
	[ Show Nearby Loci ]
Map Data	Barley, Integrated, Marcel 2009
Probe	GBS125
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Oregon Wolfe Barleys
Probe for Locus	GBS125
Locus	GBS0125 GBS0125-1H
Reference	Stein N et al. (2007) A 1000 loci transcript map of the barley genome - new anchoring points for integrative grass genomics Theoretical and Applied Genetics 114:823-839.
General Remarks	Clone HH05I03w
PCR primers	TTGTCGATCCCGTCGCTTAT TCTTCTCATGGACACTTCCGA
Amplification Conditions	5 min at 94 deg C; 50 cycles with 30 sec at 94 deg C, 1 min at 65 deg C (touchdown of 1 deg C / cycle for initial 10 cycles - final annealing of 55 deg C for remaining 40 cycles), 1 min at 72 deg C; and a final extension step of 5 min at 72 deg C
Sequence	CB861602
DNA Library	IPK-HH
Source Species	Hordeum vulgare
Source Germplasm	Sloop (barley)