Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: GBS0318-5H

[Submit comment/correction]

Locus	GBS0318-5H
Type	SNP
Map	Hv-Consensus2006-Stein-5H 60 Hv-DxR-Stein-5H 69.94
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2006, Stein Barley, OWB, Stein2006
Probe	GBS318
Probe for Locus	GBS318
Locus	GBS0318 GBS0318-5H
Reference	Stein N et al. (2007) A 1000 loci transcript map of the barley genome - new anchoring points for integrative grass genomics Theoretical and Applied Genetics 114:823-839.
General Remarks	Clone HY08O21u
PCR primers	TATCACACTGCATTCCCACAGG GCGCAGTGCGCGACAT
Amplification Conditions	5 min at 94 deg C; 50 cycles with 30 sec at 94 deg C, 1 min at 65 deg C (touchdown of 1 deg C / cycle for initial 10 cycles - final annealing of 55 deg C for remaining 40 cycles), 1 min at 72 deg C; and a final extension step of 5 min at 72 deg C
Sequence	AL511699
DNA Library	IPK-HY
Source Species	Hordeum vulgare
Source Germplasm	Barke (barley)