Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: GBS0547

[Submit comment/correction]

Locus	GBS0547
Type	SNP
Chromosome	4H
Map	Hv-Consensus2006-Marcel-4H 63.74 Hv-Integrated2009-4H 72.5
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2006, Marcel Barley, Integrated, Marcel 2009
Probe	GBS0547 GBS547
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Oregon Wolfe Dom x Rec
Probe for Locus	GBS547
Locus	GBS0547 GBS0547-4H
Reference	Stein N et al. (2007) A 1000 loci transcript map of the barley genome - new anchoring points for integrative grass genomics Theoretical and Applied Genetics 114:823-839.
General Remarks	Clone HB09K02T
PCR primers	CAGAGCAGTTGCCATGTGTTG CTCTGGTGGCAATGGGTTAAT
Amplification Conditions	5 min at 94 deg C; 50 cycles with 30 sec at 94 deg C, 1 min at 65 deg C (touchdown of 1 deg C / cycle for initial 10 cycles - final annealing of 55 deg C for remaining 40 cycles), 1 min at 72 deg C; and a final extension step of 5 min at 72 deg C
Sequence	BQ472443
DNA Library	IPK-HB
Source Species	Hordeum vulgare
Source Germplasm	Barke (barley)