Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: GBS0652

Locus	GBS0652
Type	SNP
Chromosome	6H
Map	Hv-Consensus2006-Marcel-6H 56.11 Hv-Integrated2009-6H 55.2
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2006, Marcel Barley, Integrated, Marcel 2009
Probe	GBS0652 GBS652
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Probe for Locus	GBS652
Locus	GBS0652 GBS0652-6H
Reference	Stein N et al. (2007) A 1000 loci transcript map of the barley genome - new anchoring points for integrative grass genomics Theoretical and Applied Genetics 114:823-839.
General Remarks	Clone HY05I10u
PCR primers	GCAGGCACATATTCGGCAAC AATGCAAATTGCCAAAGCTG
Amplification Conditions	5 min at 94 deg C; 50 cycles with 30 sec at 94 deg C, 1 min at 65 deg C (touchdown of 1 deg C / cycle for initial 10 cycles - final annealing of 55 deg C for remaining 40 cycles), 1 min at 72 deg C; and a final extension step of 5 min at 72 deg C
Sequence	AL510628
DNA Library	IPK-HY
Source Species	Hordeum vulgare
Source Germplasm	Barke (barley)