Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: GMS003

[Submit comment/correction]

Locus	GMS003
Type	Microsatellite
Synonym	Synonym GMS3
Chromosome	2H
Map	Barley-ConsensusFHB-2H 72.97 [ Show all 8 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	MetaQ.FHB_2H_20 MetaQ.HD_2H_11 MetaQ.HD_2H_12
Map Data	Barley, Abiotic QTL Consensus [ Show all 8 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	GMS003 GMS3
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027. Struss D and Plieske J (1998) The use of microsatellite markers for detection of genetic diversity in barley populations. Theoretical and Applied Genetics 97:308-315.
Remark	Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Lina x H. spontaneum Insert contains repeat (GT)15 Polymorphic Information Content (PIC) = 0.63 Developing laboratory = IPK (D. Struss)
Probe for Locus	GMS3
Locus	GMS0003 GMS003 GMS3
Reference	Hayden MJ et al. (2008) Multiplex-Ready PCR: A new method for multiplexed SSR and SNP genotyping BMC Genomics 9:80. Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Struss D and Plieske J (1998) The use of microsatellite markers for detection of genetic diversity in barley populations. Theoretical and Applied Genetics 97:308-315.
General Remarks	Annealing temperature = 60 deg C Insert contains repeat (gt)15
Type	SSR
PCR primers	5' TTTCAGCATCACACGAAAGC 5' TTGCATGCATGCATACCC Forward TTTCAGCATCACACGAAAGC Reverse TTGCATGCATGCATACCC TTTCAGCATCACACGAAAGC TTGCATGCATGCATACCC
SSR size	144