Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: GMS116

[Submit comment/correction]

Locus	GMS116
Type	Microsatellite
Synonym	Synonym GMS116
Chromosome	3H
Map	Barley-consensus-2003-3H 90.5 [ Show all 9 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus 2003 [ Show all 9 ]
Probe	GMS116
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Langridge, Peter J.
Remark	Number of populations contributing to the placement of GMS116 in the Barley, Consensus 2006 DArT maps = 1
Probe	GMS116
Locus	GMS0116 GMS116 GMS116A
Reference	Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Struss D and Plieske J (1998) The use of microsatellite markers for detection of genetic diversity in barley populations. Theoretical and Applied Genetics 97:308-315.
Remarks	Annealing temperature = 55 deg C Insert contains repeat (ca)16ctg(ca)4
Type	SSR
PCR primers	5' GAAAGACTGACAGGCGGAAG 5' TTTCTTTGTTGTGTGTGCAGTG GAAAGACTGACAGGCGGAAG TTTCTTTGTTGTGTGTGCAGTG
SSR size	138