Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: GMS116A

[Submit comment/correction]

Locus	GMS116A
Type	Microsatellite
Chromosome	3H
Map	Hordeum-Consensus2007-SSR-3H 69.16 Hv-Integrated2009-3H 80.1
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2007, SSR Barley, Integrated, Marcel 2009
Species	Hordeum spontaneum Hordeum vulgare
Probe	GMS116
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Struss D and Plieske J (1998) The use of microsatellite markers for detection of genetic diversity in barley populations. Theoretical and Applied Genetics 97:308-315.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' [ Show all 6 ]
Probe for Locus	GMS116
Locus	GMS0116 GMS116 GMS116A
Reference	Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Struss D and Plieske J (1998) The use of microsatellite markers for detection of genetic diversity in barley populations. Theoretical and Applied Genetics 97:308-315.
General Remarks	Annealing temperature = 55 deg C Insert contains repeat (ca)16ctg(ca)4
Type	SSR
PCR primers	5' GAAAGACTGACAGGCGGAAG 5' TTTCTTTGTTGTGTGTGCAGTG GAAAGACTGACAGGCGGAAG TTTCTTTGTTGTGTGTGCAGTG
SSR size	138