Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: GMS27

[Submit comment/correction]

Locus	GMS27
Type	Microsatellite
Chromosome	5H
Map	Hordeum-Consensus2006-DArT-5H 150.7 Hordeum-Pillen-5H 148
	[ Show Nearby Loci ]
QTL with Locus Marker	QHea.pil-5H.4 QHei.pil-5H.2 QPro.pil-5H.2 QYld.pil-5H.3
Map Data	Barley, AxHs/QTL Barley, Consensus 2006, DArT
Probe	GMS27
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Remark	Number of populations contributing to the placement of GMS27 in the Barley, Consensus 2006 DArT maps = 2
Probe	GMS27
Locus	GMS0027 GMS027 GMS27 GMS27A GMS27B
Reference	Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Struss D and Plieske J (1998) The use of microsatellite markers for detection of genetic diversity in barley populations. Theoretical and Applied Genetics 97:308-315.
Remarks	Annealing temperature = 60 deg C Insert contains repeat (gt)5(ct)2(gt)27
Type	SSR
PCR primers	5' CTTTTTCTTTGACGATGCACC 5' TGAGTTTGTGAGAACTGGATGG CTTTTTCTTTGACGATGCACC TGAGTTTGTGAGAACTGGATGG
SSR size	154