Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: HVALAAT

[Submit comment/correction]

Locus	HVALAAT
Type	Microsatellite
Synonym	Synonym HVALAAT HvALAAT.2 HvALLAT
Chromosome	1H
Chromosome Arm	1HS
Map	Barley, B73xCPI-1H 50.9 [ Show all 12 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QHea.pil-1H.3 QHei.pil-1H.1 QLoh.pil-1H.1
Map Data	Barley consensus 2003 [ Show all 12 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	HVALAAT HvALAAT.2 Pillen K et al. (2000) Mapping new EMBL-derived barley microsatellites and their use in differentiating German barley cultivars Theoretical and Applied Genetics 101:652-660. HvALLAT
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Pillen K et al. (2000) Mapping new EMBL-derived barley microsatellites and their use in differentiating German barley cultivars Theoretical and Applied Genetics 101:652-660. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Data Source	Langridge, Peter J.
Remark	Assigned to a barley chromosome by PCR screening of wheat barley addition lines Number of populations contributing to the placement of HvALAAT in the Barley, Consensus 2006 DArT maps = 1 Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Lina x H. spontaneum Insert contains repeat (CT)10 Developing laboratory = SCRI (R. Waugh)
Probe for Locus	HvALAAT.2
Locus	HVALAAT
Reference	Pillen K et al. (2000) Mapping new EMBL-derived barley microsatellites and their use in differentiating German barley cultivars Theoretical and Applied Genetics 101:652-660.
General Remarks	Insert contains repeat (c)12+(tc)9 Polymorphic Information Content (PIC) = 0.45 in 28 mainly German barley cultivars and two H. spontaneum accessions.
Type	SSR
PCR primers	Left 5' TTCCGCAGGAGGATAAGATCC Right 5' GTCTCATCTAGAGGAGGATGC
SSR size	183
Amplification Conditions	High Stringency: 10 cycles of 1 min at 94 deg C; 0.5 min starting at 64 deg. C and decreasing 1deg C per cycle, 1 min at 72 deg C, followed by 30 cycles of 1 min at 94 deg C; 1 min at 55 deg C; 1 min at 72 deg C; and a final extension step of 5 min at 72 deg C
Sequence	Z26322
Source Species	Hordeum vulgare