Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: HVDHN09

[Submit comment/correction]

Locus	HVDHN09
Type	Microsatellite
Chromosome	5H
Map	Barley-ConsensusFHB-5H 120.34 Hordeum-Consensus2007-SSR-5H 110.11 Hv-Integrated2009-5H 113.1
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, Integrated, Marcel 2009
Species	Hordeum vulgare
Probe	HVDHN09
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Becker J and Heun M (1995) Barley microsatellites: allele variation and mapping Plant Molecular Biology 27:835-845.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Igri x Franka Insert contains repeat (AC)6 Developing laboratory = MPIZ (M. Heun)
Probe	HVDHN09
Locus	HVDHN09
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Becker J and Heun M (1995) Barley microsatellites: allele variation and mapping Plant Molecular Biology 27:835-845.
Type	SSR
PCR primers	CATGGACAAGATCAAGGAGAAG CCCATTATTTATCTGTAGGAACGC