Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: HVM003

[Submit comment/correction]

Locus	HVM003
Type	Microsatellite
Synonym	Other name HVM3
Map	Hordeum-Bins-4H 54
	[ Show Nearby Loci ]
Map Data	Barley, BinMap 2005
Probe	HVM3
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Probe for Locus	HVM3
Locus	HVM3 HVM0003 HVM003 HVM03 HVM03-4H
Reference	Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Fu YB et al. (2007) Microsatellite variation in Avena sterilis oat germplasm Theoretical and Applied Genetics 114:1029-1038. Saghai Maroof MA et al. (1994) Extraordinarily polymorphic microsatellite DNA in barley: species diversity, chromosomal locations, and population dynamics. Proceedings of the National Academy of Sciences, USA 91:5466-5470.
General Remarks	Insert contains repeat (AT)29. In 369 Avena sterilis accessions there were 3 alleles of size 138-142 bp, PIC = negative.
Type	Genomic PCR SSR
PCR primers	5' ACACCTTCCCAGGACAATCCATTG 3' 5' AGCACGCAGAGCACCGAAAAAGTC 3' ACACCTTCCCAGGACAATCCATTG AGCACGCAGAGCACCGAAAAAGTC
SSR size	0.188
Amplification Conditions	PCR comprised one cycle of 94oC for 3 min, 55oC for 2 min, and 72oC for 1.5 min, followed by 30 cycles of 94oC for 1 min, 55oC for 2 min, and 72oC for 1.5 min.
Sequence	M55449
Insert Enzyme	TaqI
Source Gene Class	Ribulose bisphosphate carboxylase activase
Source Species	Hordeum vulgare
Source Germplasm	Old ZZ (barley)
DNA Origin	Size-fractionated genomic library screened with synthetic dinucleotide repeats (CA)10 and (GA)10.