Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: HVM005

[Submit comment/correction]

Locus	HVM005
Type	Microsatellite
Synonym	Other name HVM5 Synonym HVM5
Chromosome	7H
Map	Hordeum-Bins-7H 144.7 Hordeum-Consensus2005-SNP-7H 153.113 Hordeum-QTLConsensus-Abiotic-7H 153.11 Hordeum-QTLConsensus-Agronomic-7H 153.11 Hordeum-StMo-SNP-7H 139.4
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, BinMap 2005 Barley, Consensus 2005, SNP Barley, Steptoe x Morex, SNP
Probe	HVM5
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Probe for Locus	HVM5
Locus	HVM5 HVM005 HVM05
Reference	Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
General Remarks	Pathogenesis-related protein Insert contains repeats (GT)6 and (AT)16.
Type	PCR SSR
PCR primers	5' AACGACGTCGCCACACAC 3' 5' AGGAACGAAGGGAGTATTAAGCAG 3'
SSR size	0.202
Amplification Conditions	PCR comprised one cycle of 94oC for 3 min, 55oC for 2 min, and 72oC for 1.5 min, followed by 30 cycles of 94oC for 1 min, 55oC for 2 min, and 72oC for 1.5 min.
Sequence	X58566
Insert Enzyme	TaqI
Source Species	Hordeum vulgare
Source Germplasm	Old ZZ (barley)
DNA Origin	Size-fractionated genomic library screened with synthetic dinucleotide repeats (CA)10 and (GA)10.