Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: HVM03

[Submit comment/correction]

Locus	HVM03
Type	Microsatellite
Chromosome	4H
Map	Barley-ConsensusFHB-4H 64 Hordeum-Consensus2007-SSR-4H 58.33 Hv-Consensus2006-Marcel-4H 58.33 Hv-Integrated2009-4H 66.6 Hv-Vada/SusPtrit-4H 26.56
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2006, Marcel Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, Integrated, Marcel 2009 Barley, Vada x SusPtrit
Species	Hordeum spontaneum Hordeum vulgare
Probe	HVM03-337 HVM3
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' [ Show all 7 ]
Probe for Locus	HVM3
Locus	HVM3 HVM0003 HVM003 HVM03 HVM03-4H
Reference	Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Fu YB et al. (2007) Microsatellite variation in Avena sterilis oat germplasm Theoretical and Applied Genetics 114:1029-1038. Saghai Maroof MA et al. (1994) Extraordinarily polymorphic microsatellite DNA in barley: species diversity, chromosomal locations, and population dynamics. Proceedings of the National Academy of Sciences, USA 91:5466-5470.
General Remarks	Insert contains repeat (AT)29. In 369 Avena sterilis accessions there were 3 alleles of size 138-142 bp, PIC = negative.
Type	Genomic PCR SSR
PCR primers	5' ACACCTTCCCAGGACAATCCATTG 3' 5' AGCACGCAGAGCACCGAAAAAGTC 3' ACACCTTCCCAGGACAATCCATTG AGCACGCAGAGCACCGAAAAAGTC
SSR size	0.188
Amplification Conditions	PCR comprised one cycle of 94oC for 3 min, 55oC for 2 min, and 72oC for 1.5 min, followed by 30 cycles of 94oC for 1 min, 55oC for 2 min, and 72oC for 1.5 min.
Sequence	M55449
Insert Enzyme	TaqI
Source Gene Class	Ribulose bisphosphate carboxylase activase
Source Species	Hordeum vulgare
Source Germplasm	Old ZZ (barley)
DNA Origin	Size-fractionated genomic library screened with synthetic dinucleotide repeats (CA)10 and (GA)10.