Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: HVM14

[Submit comment/correction]

Locus	HVM14
Type	Microsatellite
Synonym	Correct name HVM014 Synonym HVM14
Chromosome	6H
Map	Barley-consensus-2003-6H 17.5 [ Show all 12 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus 2003 [ Show all 12 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	HVM14 Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Data Source	Langridge, Peter J.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' [ Show all 6 ]
Probe	HVM14
Locus	HVM14 HVM014
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Remarks	Insert contains repeat (CA)11.
Type	PCR SSR
PCR primers	5' CGATCAAGGACATTTGGGTAAT 3' 5' AACTCTTCGGGTTCAACCAATA 3' CGATCAAGGACATTTGGGTAAT AACTCTTCGGGTTCAACCAATA
SSR size	0.158
Amplification Conditions	The 'touchdown' PCR comprised 48 cycles of 94oC for 1 min denaturing and 72oC for 1 min extension. Annealing (30 s) temperatures were progressively decreased by 1oC every second cycle from 64oC to 55oC. Annealing conditions of 1 min at 55oC were maintained during the final 30 cycles. The reaction ended with a 5-min extension at 72oC.
Insert Enzyme	TaqI
Source Species	Hordeum vulgare
Source Germplasm	Old ZZ (barley)
DNA Origin	Size-fractionated genomic library screened with synthetic dinucleotide repeats (CA)10 and (GA)10.