Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: HVM23

[Submit comment/correction]

Locus	HVM23
Type	Microsatellite
Synonym	Correct name HVM023 Synonym HVM23
Chromosome	2H
Map	Barley-consensus-2003-2H 67.2 [ Show all 10 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus 2003 [ Show all 10 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	HVM23 Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source	Langridge, Peter J.
Remark	Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Lina x H. spontaneum Insert contains repeat (GA)9 Developing laboratory = VPISU (MA Saghai Maroof)
Probe	HVM23
Locus	HVM23 HVM023
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Remarks	Insert contains repeat (GA)9.
Type	PCR SSR
PCR primers	5' TCGGTGAAGAAATACGAGGC 3' 5' TCTTTGTAGACCTACCGGTCC 3' TCGGTGAAGAAATACGAGGC TCTTTGTAGACCTACCGGTCC
SSR size	0.246
Amplification Conditions	The 'touchdown' PCR comprised 38 cycles of 94oC for 1 min denaturing, and 72oC for 1 min extension. Annealing (30 sec) temperatures were progressively decreased by 1oC every second cycle from 69oC to 60oC, at which temperature they remained constant for the final 20 cycles. The reaction ended with a 5-min extension at 72oC.
Insert Enzyme	TaqI
Source Species	Hordeum vulgare
Source Germplasm	Old ZZ (barley)
DNA Origin	Size-fractionated genomic library screened with synthetic dinucleotide repeats (CA)10 and (GA)10.