Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: HVM43

[Submit comment/correction]

Locus	HVM43
Type	Microsatellite
Synonym	Correct name HVM043 Synonym HVM43
Chromosome	1H
Map	Hordeum-Consensus2005-SNP-1H 69.105 Hordeum-Lx41-1H 53.6 Hordeum-QTLConsensus-Abiotic-1H 69.11 Hordeum-QTLConsensus-Agronomic-1H 69.11 Hordeum-StMo-SNP-1H 75.95
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, Consensus 2005, SNP Barley, Lx41 Barley, Steptoe x Morex, SNP
Probe	HVM43 Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Probe	HVM43
Locus	HVM43 HVM043
Reference	Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Remarks	Insert contains repeat (CA)9.
Type	PCR SSR
PCR primers	5' GGATTTTCTCAAGAACACTT 3' 5' GCGTGAGTGCATAACATT 3'
SSR size	0.239
Amplification Conditions	The 'touchdown' PCR comprised 48 cycles of 94oC for 1 min denaturing and 72oC for 1 min extension. Annealing (30 s) temperatures were progressively decreased by 1oC every second cycle from 64oC to 55oC. Annealing conditions of 1 min at 55oC were maintained during the final 30 cycles. The reaction ended with a 5-min extension at 72oC.
Insert Enzyme	TaqI
Source Species	Hordeum vulgare
Source Germplasm	Old ZZ (barley)
DNA Origin	Size-fractionated genomic library screened with synthetic dinucleotide repeats (CA)10 and (GA)10.