Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: HVM44

[Submit comment/correction]

Locus	HVM44
Type	Microsatellite
Synonym	Correct name HVM044 Synonym HVM44
Chromosome	3H
Map	Barley-ConsensusFHB-3H 57.19 [ Show all 10 ]
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus [ Show all 10 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	HVM44 Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Remark	Number of populations contributing to the placement of HVM44 in the Barley, Consensus 2006 DArT maps = 1 Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Lina x H. spontaneum Insert contains repeat (GA)8 Polymorphic Information Content (PIC) = 0.18 Developing laboratory = VPISU (MA Saghai Maroof)
Probe	HVM44
Locus	HVM44 HVM0044 HVM044
Reference	Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Remarks	Insert contains repeat (GA)8.
Type	PCR SSR
PCR primers	5' AAATCTCAGGTTCGTGGGCA 3' 5' CCACGGAGACCACCTCACTT 3' AAATCTCAGGTTCGTGGGCA CCACGGAGACCACCTCACTT
SSR size	0.114
Amplification Conditions	The 'touchdown' PCR comprised 48 cycles of 94oC for 1 min denaturing and 72oC for 1 min extension. Annealing (30 s) temperatures were progressively decreased by 1oC every second cycle from 64oC to 55oC. Annealing conditions of 1 min at 55oC were maintained during the final 30 cycles. The reaction ended with a 5-min extension at 72oC.
Insert Enzyme	TaqI
Source Species	Hordeum vulgare
Source Germplasm	Old ZZ (barley)
DNA Origin	Size-fractionated genomic library screened with synthetic dinucleotide repeats (CA)10 and (GA)10.