Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: HVM49

[Submit comment/correction]

Locus	HVM49
Type	Microsatellite
Synonym	Correct name HVM049
Chromosome	7H
Chromosome Arm	7HL
Map	Barley-consensus-2003-7H 161.4 [ Show all 8 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus 2003 [ Show all 8 ]
Species	Hordeum spontaneum Hordeum vulgare Hordeum vulgare subsp. spontaneum
Probe	HVM49 Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source	Langridge, Peter J.
Remark	Number of populations contributing to the placement of HVM49 in the Barley, Consensus 2006 DArT maps = 1 Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Lina x H. spontaneum Insert contains repeat (CA)12 Developing laboratory = VPISU (MA Saghai Maroof)
Probe	HVM49
Locus	HVM49 HVM0049 HVM049
Reference	Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Remarks	Insert contains repeat (CA)12.
Type	PCR SSR
PCR primers	5' CTCTATAGGCACGAAAAATTCC 5' TTGCACATATCTCTCTGTCACA 3' CTCTATAGGCACGAAAAATTCC TTGCACATATCTCTCTGTCACA
SSR size	0.105
Amplification Conditions	The 'touchdown' PCR comprised 48 cycles of 94oC for 1 min denaturing and 72oC for 1 min extension. Annealing (30 s) temperatures were progressively decreased by 1oC every second cycle from 64oC to 55oC. Annealing conditions of 1 min at 55oC were maintained during the final 30 cycles. The reaction ended with a 5-min extension at 72oC.
Insert Enzyme	TaqI
Source Species	Hordeum vulgare
Source Germplasm	Old ZZ (barley)
DNA Origin	Size-fractionated genomic library screened with synthetic dinucleotide repeats (CA)10 and (GA)10.