Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: HVM54

[Submit comment/correction]

Locus	HVM54
Type	Microsatellite
Synonym	Correct name HVM054 Synonym HVM54
Chromosome	2H
Chromosome Arm	2HL
Map	Barley-consensus-2003-2H 129.2 [ Show all 16 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	MetaQ.FHB_2H_40 [ Show all 6 ]
Map Data	Barley consensus 2003 [ Show all 16 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	HVM54 Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318. Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Data Source	Langridge, Peter J.
Remark	Number of populations contributing to the placement of HVM54 in the Barley, Consensus 2006 DArT maps = 4 [ Show all 8 ]
Probe	HVM54
Locus	HVM54 HVM0054 HVM054
Reference	Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Remarks	Insert contains repeat (GA)14.
Type	PCR SSR
PCR primers	5' AACCCAGTAACACCGTCCTG 3' 5' AGTTCCCTGACCCGATGTC 3' AACCCAGTAACACCGTCCTG AGTTCCCTGACCCGATGTC AACCCAGTAACACCTGTCCTGHVCSG PCR_primers
SSR size	0.159
Amplification Conditions	The 'touchdown' PCR comprised 48 cycles of 94oC for 1 min denaturing and 72oC for 1 min extension. Annealing (30 s) temperatures were progressively decreased by 1oC every second cycle from 64oC to 55oC. Annealing conditions of 1 min at 55oC were maintained during the final 30 cycles. The reaction ended with a 5-min extension at 72oC. SSR_size
Insert Enzyme	TaqI
Source Species	Hordeum vulgare
Source Germplasm	Old ZZ (barley)
DNA Origin	Size-fractionated genomic library screened with synthetic dinucleotide repeats (CA)10 and (GA)10.