Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: HVM68

[Submit comment/correction]

Locus	HVM68
Type	Microsatellite RFLP
Synonym	Correct name HVM068 Synonym HVM68
Chromosome	4H
Chromosome Arm	4HL
Map	Barley-ConsensusFHB-4H 76.8 [ Show all 19 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QHt.HaMo-4H.3
Map Data	Barley, Abiotic QTL Consensus [ Show all 19 ]
Species	Hordeum vulgare Hordeum vulgare subsp. spontaneum
Probe	HVM68 Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117. [ Show all 6 ]
Remark	Number of populations contributing to the placement of HVM68 in the Barley, Consensus 2006 DArT maps = 3 [ Show all 8 ]
Probe	HVM68
Locus	HVM68 HVM0068 HVM068
Reference	Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Remarks	Insert contains repeat (GA)22.
Type	PCR SSR
PCR primers	5' AGGACCGGATGTTCATAACG 3' 5' CAAATCTTCCAGCGAGGCT 3' AGGACCGGATGTTCATAACG CAAATCTTCCAGCGAGGCT
SSR size	0.204
Amplification Conditions	The 'touchdown' PCR comprised 48 cycles of 94oC for 1 min denaturing and 72oC for 1 min extension. Annealing (30 s) temperatures were progressively decreased by 1oC every second cycle from 64oC to 55oC. Annealing conditions of 1 min at 55oC were maintained during the final 30 cycles. The reaction ended with a 5-min extension at 72oC.
Insert Enzyme	TaqI
Source Species	Hordeum vulgare
Source Germplasm	Old ZZ (barley)
DNA Origin	Size-fractionated genomic library screened with synthetic dinucleotide repeats (CA)10 and (GA)10.