Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: HVM9

[Submit comment/correction]

Locus	HVM9
Type	Microsatellite
Synonym	Correct name HVM009
Chromosome	3H
Chromosome Arm	3HS
Map	Hv-HNxH602-3H 88.5
	[ Show Nearby Loci ]
Map Data	Barley, HN x H602, Sato2009
Species	Hordeum vulgare Hordeum vulgare subsp. spontaneum
Probe	HVM9 Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Probe	HVM9
Locus	HVM9 HVM0009 HVM009
Reference	Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Saghai Maroof MA et al. (1994) Extraordinarily polymorphic microsatellite DNA in barley: species diversity, chromosomal locations, and population dynamics. Proceedings of the National Academy of Sciences, USA 91:5466-5470.
Remarks	Seed imbibition protein. Insert contains repeat (TCT)5.
Type	PCR SSR
PCR primers	5' CTTCGACACCATCACCCAG 3' 5' ACCAAAATCGCATCGAACAT 3' CTTCGACACCATCACCCAG ACCAAAATCGCATCGAACAT
SSR size	0.221
Amplification Conditions	PCR comprised one cycle of 94oC for 3 min, 55oC for 2 min, and 72oC for 1.5 min, followed by 30 cycles of 94oC for 1 min, 55oC for 2 min, and 72oC for 1.5 min.
Sequence	M77475
Insert Enzyme	TaqI
Source Species	Hordeum vulgare
Source Germplasm	Old ZZ (barley)
DNA Origin	Size-fractionated genomic library screened with synthetic dinucleotide repeats (CA)10 and (GA)10.