Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: HVOle

[Submit comment/correction]

Locus	HVOle
Type	Microsatellite
Chromosome	4H
Map	Barley, B73xCPI-4H 27.4 [ Show all 6 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus 2003 [ Show all 6 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	HVOle
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Data Source	Langridge, Peter J.
Remark	Number of populations contributing to the placement of HvOle in the Barley, Consensus 2006 DArT maps = 1 Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Lina x H. spontaneum Insert contains repeat (GCCT)4 Polymorphic Information Content (PIC) = 0.26 Developing laboratory = SCRI (R. Waugh)
Probe	HVOle
Locus	HVOle
Synonym	Synonym HAR35_14 HAR35_29681 HAR35_37221
Reference	Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remarks	Insert contains repeat (GCCT)4 Quality = 1: Single product, only weak stutter bands Diversity Index (DI) = 0.26
Type	PCR SSR
PCR primers	5' GATGGATGTCAGTCGGTC 3' 5' ATGAGCAGTAGTACAACTCTAAGC 3' GATGGATGTCAGTCGGTC ATGAGCAGTAGTACAACTCTAAGC
SSR size	198
Amplification Conditions	1 cycle of 3 min @ 94C, 1 min @ 53C, 1 min @ 72C, 30 cycles of 30 secs @ 94C, 30 secs @ 53C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Sequence	X82677
Source Species	Hordeum vulgare