Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Hv26916

[Submit comment/correction]

Locus	Hv26916
Type	Microsatellite
Chromosome	2H, 4H + 5H 4H
Map	Barley, B73xCPI-4H 56.3 Hordeum-Consensus2006-DArT-4H 69.7 Hordeum-Lx41-2H 150.3
	[ Show Nearby Loci ]
Map Data	Barley, B73xCPI Barley, Consensus 2006, DArT Barley, Lx41
Probe	Hv26916
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Pillen K et al. (2000) Mapping new EMBL-derived barley microsatellites and their use in differentiating German barley cultivars Theoretical and Applied Genetics 101:652-660.
Remark	Assigned to a barley chromosome by PCR screening of wheat barley addition lines Number of populations contributing to the placement of Hv26916 in the Barley, Consensus 2006 DArT maps = 1
Probe	Hv26916
Locus	Hv26916
Reference	Hayden MJ et al. (2008) Multiplex-Ready PCR: A new method for multiplexed SSR and SNP genotyping BMC Genomics 9:80. Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Pillen K et al. (2000) Mapping new EMBL-derived barley microsatellites and their use in differentiating German barley cultivars Theoretical and Applied Genetics 101:652-660.
Remarks	Insert contains repeat (cct)8
Type	SSR
PCR primers	ACTCTCCAGCTCGCTCCTCG GGCTCTCGGCTCTTGCTCTG Forward ACTCTCCAGCTCGCTCCTCG Reverse GGCTCTCGGCTCTTGCTCTG Left 5' ACTCTCCAGCTCGCTCCTCG Right 5' GGCTCTCGGCTCTTGCTCTG
SSR size	105
Amplification Conditions	Low Stringency: 35 cycles of 1 min at 94 deg C; 1 min at 50 deg C; 2 min at 72 deg C; and a final extension step of 5 min at 72 deg C
Sequence	U26916
Source Species	Hordeum vulgare