Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Hv49505

[Submit comment/correction]

Locus	Hv49505
Type	Microsatellite
Chromosome	3H
Map	Barley, B73xCPI-7H 36.2
	[ Show Nearby Loci ]
Map Data	Barley, B73xCPI
Probe	Hv49505
Reference	Pillen K et al. (2000) Mapping new EMBL-derived barley microsatellites and their use in differentiating German barley cultivars Theoretical and Applied Genetics 101:652-660.
Remark	Assigned to a barley chromosome by PCR screening of wheat barley addition lines
Probe	Hv49505
Locus	Hv49505
Synonym	Synonym HAR35_46748
Reference	Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Pillen K et al. (2000) Mapping new EMBL-derived barley microsatellites and their use in differentiating German barley cultivars Theoretical and Applied Genetics 101:652-660.
Remarks	Insert contains repeat (a)8 Polymorphic Information Content (PIC) = 0.47 in 28 mainly German barley cultivars and two H. spontaneum accessions.
Type	SSR
PCR primers	Left 5' TGTCGGTTGGTGATGTGTCG Right 5' AAAGCAGCAGCAGAACCCAC TGTCGGTTGGTGATGTGTCG AAAGCAGCAGCAGAACCCAC
SSR size	152
Amplification Conditions	Low Stringency: 35 cycles of 1 min at 94 deg C; 1 min at 50 deg C; 2 min at 72 deg C; and a final extension step of 5 min at 72 deg C
Sequence	U49505
Source Species	Hordeum vulgare