Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Hv5s

[Submit comment/correction]

Locus	Hv5s
Type	Microsatellite
Chromosome	2H
Map	Barley, B73xCPI-2H 87 Barley-ConsensusFHB-2H 83.47 Hordeum-Consensus2006-DArT-2H 95.4 Hordeum-Consensus2007-SSR-2H 88.97 Hordeum-LxHs-2H 62
	[ Show Nearby Loci ]
Map Data	Barley, B73xCPI Barley, Consensus 2006, DArT Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, LxHs
Species	Hordeum spontaneum Hordeum vulgare
Probe	Hv5s
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Number of populations contributing to the placement of Hv5s in the Barley, Consensus 2006 DArT maps = 1 Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Lina x H. spontaneum Insert contains repeat (AGT)5 Developing laboratory = SCRI (R. Waugh)
Probe	Hv5s
Locus	Hv5s Hv5sA Hv5sB
Reference	Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remarks	Insert contains repeat (AGT)5 Quality = 3: Strong major polymorphic product, with additional strong bands. Multi-locus or weak but scoreable products
Type	PCR SSR
PCR primers	5' CCTCATTTACTTATTTTTGACG 3' 5' AATGCAACACGAGGACTT 3' CCTCATTTACTTATTTTTGACG AATGCAACACGAGGACTT
SSR size	238
Amplification Conditions	1 cycle of 3 min @ 94C, 1 min @ 58C, 1 min @ 72C, 30 cycles of 30 secs @ 94C, 30 secs @ 58C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Sequence	Z11436
Source Species	Hordeum vulgare