Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: HvCW21

[Submit comment/correction]

Locus	HvCW21
Chromosome	3H
Map	Hordeum-Consensus2006-DArT-3H 26.8
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2006, DArT
Probe	HvCW21
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Pillen K et al. (2000) Mapping new EMBL-derived barley microsatellites and their use in differentiating German barley cultivars Theoretical and Applied Genetics 101:652-660.
Remark	Assigned to a barley chromosome by PCR screening of wheat barley addition lines Number of populations contributing to the placement of HvCW21 in the Barley, Consensus 2006 DArT maps = 1
Probe	HvCW21
Locus	HvCW21
Reference	Pillen K et al. (2000) Mapping new EMBL-derived barley microsatellites and their use in differentiating German barley cultivars Theoretical and Applied Genetics 101:652-660.
Remarks	Insert contains repeat (ag)6 Polymorphic Information Content (PIC) = 0.27 in 28 mainly German barley cultivars and two H. spontaneum accessions.
Type	SSR
PCR primers	Left 5' ATAGCCCCAGCAATCGACGC Right 5' GCCATGCAGAACTGGCTCAAC
SSR size	153
Amplification Conditions	High Stringency: 10 cycles of 1 min at 94 deg C; 0.5 min starting at 64 deg. C and decreasing 1deg C per cycle, 1 min at 72 deg C, followed by 30 cycles of 1 min at 94 deg C; 1 min at 55 deg C; 1 min at 72 deg C; and a final extension step of 5 min at 72 deg C
Source Species	Hordeum vulgare