Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: HvKASI

[Submit comment/correction]

Locus	HvKASI
Type	Microsatellite
Chromosome	2H
Map	Barley-ConsensusFHB-2H 73.03 Hordeum-Consensus2007-SSR-2H 67.01
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB
Species	Hordeum spontaneum Hordeum vulgare
Probe	HvKASI
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Becker J and Heun M (1995) Barley microsatellites: allele variation and mapping Plant Molecular Biology 27:835-845.
Remark	Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Lina x H. spontaneum Insert contains repeat (C)10 Polymorphic Information Content (PIC) = 0.17 Developing laboratory = MPIZ (M. Heun)
Probe	HvKASI
Locus	HvKASI
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Becker J and Heun M (1995) Barley microsatellites: allele variation and mapping Plant Molecular Biology 27:835-845.
Type	SSR
PCR primers	ATTGGCGTGACCGATATTTATGTTCA CAAAACTGCAGCTAAGCAGGGGAACA