Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: HvKNOX3

[Submit comment/correction]

Locus	HvKNOX3
Type	Gene IFLP Microsatellite STS
Synonym	Synonym Kap (Hordeum)
Chromosome	4H 4H + 7H
Map	Barley-ConsensusFHB-4H 48.01 [ Show all 13 ]
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus [ Show all 13 ]
Species	Hordeum vulgare
Probe	hvKnox 3B/3C HvKNOX3
Associated Gene	Kap (Hordeum)
Gene Class	Hooded/elevated hooded/awned lemma
Image	PCR of Hvknox3 in the OWBs
Reference	Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. [ Show all 7 ]
Remark	Assigned to a barley chromosome by PCR screening of wheat barley addition lines [ Show all 9 ]
Probe for Locus	hvKnox 3B/3C
Locus	HvKNOX3
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Type	PCR
PCR primers	3B 5' CCCCTCAAAGTTCAGGTCAATCCT 3C 5' ACATCAATCAGAAAAGAAAGCATT