Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: HvLOX

[Submit comment/correction]

Locus	HvLOX
Type	Gene Microsatellite
Synonym	Synonym HvLOX
Chromosome	5H 6H
Map	Barley, B73xCPI-6H 50.5 [ Show all 14 ]
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus [ Show all 11 ]
Species	Hordeum spontaneum Hordeum vulgare Hordeum vulgare subsp. spontaneum
Probe	HvLOX
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Number of populations contributing to the placement of HvLOX in the Barley, Consensus 2006 DArT maps = 1 Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Lina x H. spontaneum Insert contains repeat (AG)9 Polymorphic Information Content (PIC) = 0.48 Developing laboratory = SCRI (R. Waugh)
Probe	HvLOX
Locus	HvLOX
Reference	Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remarks	Insert contains repeat (AG)9 Quality = 1: Single product, only weak stutter bands Diversity Index (DI) = 0.48
Type	PCR SSR
PCR primers	5' CAGCATATCCATCTGATCTG 3' 5' CACCCTTATTTATTGCCTTAA 3' CAGCATATCCATCTGATCTG CACCCTTATTTATTGCCTTAA
SSR size	150
Amplification Conditions	1 cycle of 3 min @ 94C, 1 min @ 58C, 1 min @ 72C, 30 cycles of 30 secs @ 94C, 30 secs @ 58C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Sequence	L37358
Source Species	Hordeum vulgare