Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: HvX

[Submit comment/correction]

Locus	HvX
Chromosome	2H + 4H + 6H
Probe	HvX
Reference	Pillen K et al. (2000) Mapping new EMBL-derived barley microsatellites and their use in differentiating German barley cultivars Theoretical and Applied Genetics 101:652-660.
Remark	Assigned to a barley chromosome by PCR screening of wheat barley addition lines
Probe	HvX
Locus	HvX
Reference	Pillen K et al. (2000) Mapping new EMBL-derived barley microsatellites and their use in differentiating German barley cultivars Theoretical and Applied Genetics 101:652-660.
Remarks	Insert contains repeat (agg)4
Type	SSR
PCR primers	Left 5' CCTACTCCTCGCCCAGGTCC Right 5' ACTAGATGGAGCGCCGATGG
SSR size	220
Amplification Conditions	Low Stringency: 35 cycles of 1 min at 94 deg C; 1 min at 50 deg C; 2 min at 72 deg C; and a final extension step of 5 min at 72 deg C
Sequence	L43946
Source Species	Hordeum vulgare