Query (optional) in Class All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data GrainGenes Marker Report: IB-267 ProbeIB-267 LocusSrR Reference Mago R et al. (2002) Identification and mapping of molecular markers linked to rust resistance genes located on chromosome 1RS of rye using wheat-rye translocation lines Theoretical and Applied Genetics 104:1317-1324. TypeSTS STS primers5' GCAAGTAAGCAGCTTGATTTAGC 3'5' AATGGATGTCCCGGTGAGTGG 3'