Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: IWA7777

[Submit comment/correction]

Locus	IWA7777
Type	SNP
Synonym	Other name BS00185561 wsnp_Ra_c24707_34262900 Wang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796.
Chromosome Arm	5A
Map	Durum Wheat, NSGC Lr 5A 43 [ Show all 10 ]
	[ Show Nearby Loci ]
Map Data	Durum Wheat, NSGC Lr [ Show all 10 ]
Species	Triticum aestivum
Probe	IWA7777_KASP wsnp_Ra_c24707_34262900
Reference	Wang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796. Cavanagh CR et al. (2013) Genome-wide comparative diversity uncovers multiple targets of selection for improvement in hexaploid wheat landraces and cultivars Proceedings of the National Academy of Sciences, USA 110:8057-8062.
Possible Orthologs	iwa7777-5A
Probe for Locus	IWA7777_KASP
Locus	wsnp_Ra_c24707_34262900 IWA7777
Reference	Pandurangan S et al. (2021) Validation of a SNP-KASP marker for the Fusarium head blight resistance quantitative trait loci on chromosome 5AS Canadian Journal of Plant Science 101:135-139.
PCR primers	IWA7777-Fam GAAGGTGACCAAGTTCATGCTtcagcatacatttgtgcaactttA IWA7777-Hex GAAGGTCGGAGTCAACGGATTtcagcatacatttgtgcaactttG IWA7777-KaspR attaacttcttcaaagacaccgtc