Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: IWB28967

[Submit comment/correction]

Locus	IWB28967
Type	SNP
Synonym	Other name BS00133491 Excalibur_c8066_791 Wang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796.
Chromosome Arm	7A
Map	Wheat, Yr genes and QTL 7A 65.3 Wheat_2014_90KSNP_7A 201.461
	[ Show Nearby Loci ]
Map Data	Wheat, Yr genes and QTL Wheat_2014_90KSNP
Species	Triticum aestivum
Probe	Excalibur_c8066_791 IWB28967
Reference	Babiker EM et al. (2015) Mapping resistance to the Ug99 race group of the stem rust pathogen in a spring wheat landrace Theoretical and Applied Genetics 128:605-612. Wang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796. MAS Wheat. Bringing Genomics to the Wheat Fields. Disease resistance. Stem Rust Resistance. QSr.abr-7AL MAS Wheat. Marker Assisted Selection in Wheat.
Probe for Locus	IWB28967
Locus	IWB28967
Reference	Babiker EM et al. (2015) Mapping resistance to the Ug99 race group of the stem rust pathogen in a spring wheat landrace Theoretical and Applied Genetics 128:605-612. MAS Wheat. Bringing Genomics to the Wheat Fields. Disease resistance. Stem Rust Resistance. QSr.abr-7AL MAS Wheat. Marker Assisted Selection in Wheat.
PCR primers	F_ALA: 5' AAACAACGGGTTCTTGCAGAGCAT F_ALG: 5' ACAACGGGTTCTTGCAGAGCAC R: 5' CGATAAAGGAGATATCTTCCTGCAAGTAT
Specificity	Forward primers are allele specific for SNPs A and G, respectively