Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: IWB39516

[Submit comment/correction]

Locus	IWB39516
Type	SNP
Synonym	Other name BS00144040 Ku_c4813_494 Wang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796.
Chromosome Arm	2B
Map	Wheat, Yr genes and QTL 2B 51.2 Wheat_2014_90KSNP_2B 99.7308 Wheat_Yr_2021-2B 168.49
	[ Show Nearby Loci ]
Map Data	Wheat, Yr genes and QTL Wheat, Yr Update, 2021 Wheat_2014_90KSNP
Species	Triticum aestivum
Probe	fcp717_KASP Ku_c4813_494
Reference	Sharma JS et al. (2019) Mapping and characterization of two stem rust resistance genes derived from cultivated emmer wheat accession PI 193883. Theoretical and Applied Genetics 132:3177-3189. Wang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796.
Probe for Locus	fcp717_KASP
Locus	fcp717 IWB39516
Reference	Sharma JS et al. (2019) Mapping and characterization of two stem rust resistance genes derived from cultivated emmer wheat accession PI 193883. Theoretical and Applied Genetics 132:3177-3189.
General Remarks	~Product size (bp) = 25, 50 Inheritance/phase = Dominant/repulsion
Type	KASP
PCR primers	F1 {tail-1}GGCTCGATTGCCTCGT F2 {tail-2}GGCTCGATTGCCCTGC R CAAAACCGTGATCTCCACAAAA