Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: IWB46162

[Submit comment/correction]

Locus	IWB46162
Type	SNP
Synonym	Other name BS00150686 Kukri_c51453_406 Wang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796.
Chromosome Arm	7A
Map	Wheat, Yr genes and QTL 7A 74.8 Wheat_2014_90KSNP_7A 224.833 Wheat_Yr_2021-7A 186.02
	[ Show Nearby Loci ]
Map Data	Wheat, Yr genes and QTL Wheat, Yr Update, 2021 Wheat_2014_90KSNP
Species	Triticum aestivum
Probe	IWB46162 Kukri_c51453_406
Reference	Babiker EM et al. (2015) Mapping resistance to the Ug99 race group of the stem rust pathogen in a spring wheat landrace Theoretical and Applied Genetics 128:605-612. Wang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796. MAS Wheat. Bringing Genomics to the Wheat Fields. Disease resistance. Stem Rust Resistance. QSr.abr-7AL MAS Wheat. Marker Assisted Selection in Wheat.
Probe for Locus	IWB46162
Locus	IWB46162
Reference	Babiker EM et al. (2015) Mapping resistance to the Ug99 race group of the stem rust pathogen in a spring wheat landrace Theoretical and Applied Genetics 128:605-612. MAS Wheat. Bringing Genomics to the Wheat Fields. Disease resistance. Stem Rust Resistance. QSr.abr-7AL MAS Wheat. Marker Assisted Selection in Wheat.
PCR primers	F_ALT: 5' GAACTACGACAGCGTCTGGATCA F_ALC: 5' AACTACGACAGCGTCTGGATCG R: 5' ATCAACCCATGCTTTTGAAGAAGGAAATTA
Specificity	Forward primers are allele specific for SNPs T and C, respectively