Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MGB84 (HVBA

[Submit comment/correction]

Locus	MGB84 (HVBA
Probe	MGB84 (HVBA
Probe	MGB84 (HVBA
Locus	MGB84 MGB84 (HVBA
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Pillen K et al. (2000) Mapping new EMBL-derived barley microsatellites and their use in differentiating German barley cultivars Theoretical and Applied Genetics 101:652-660.
Type	SSR
PCR primers	CAAGCAAAAGGTTAAAGGTGCC TTGTCGAAACCCATCCGCTC