Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MTK4

[Submit comment/correction]

Locus	MTK4
Type	CAPS
Chromosome	5A
Chromosome Arm	5AL
Map	5AL, Vrn1 region -0.74
	[ Show Nearby Loci ]
Map Data	5AL, Vrn1 region
Species	Triticum monococcum
Probe	AY244512/3
Associated Gene	MTK4-A1 (Triticum)
Gene Class	Protein kinase
Reference	Yan L et al. (2003) Positional cloning of the wheat vernalization gene VRN1 Proceedings of the National Academy of Sciences, USA 100:6263-6268.
Data Source	Dubcovsky, Jorge 2003.04
Remark	Tousled-like kinase MTK4
Probe for Locus	AY244512/3
Locus	MTK4
Reference	Yan L et al. (2003) Positional cloning of the wheat vernalization gene VRN1 Proceedings of the National Academy of Sciences, USA 100:6263-6268.
General Remarks	Tousled-like kinase MTK4
Type	Genomic STS
PCR primers	MTK4_F GGTAAAAGATGAGCAAGGAG MTK4-R TCTATCTATGGTGAACTCTTACTTC
Sequence	AY244513 AY244512
Source Gene Class	Protein kinase
Source Gene	MTK4-A1 (Triticum)
Source Species	Triticum monococcum