Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG2031

[Submit comment/correction]

Locus	MWG2031
Type	RFLP STS
Chromosome	7H
Chromosome Arm	7HL 7HS
Map	Barley-Consensus-7H -2.8 [ Show all 13 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	MetaQ.HT_7H_5 [ Show all 10 ]
Map Data	Barley consensus [ Show all 13 ]
Species	Hordeum vulgare Hordeum vulgare subsp. spontaneum
Probe	MWG2031
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117. Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Data Source	Kleinhofs, Andris
Remark	Number of populations contributing to the placement of MWG2031 in the Barley, Consensus 2006 DArT maps = 1 This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	MWG2031-7H Xmwg2031
Probe	MWG2031
Locus	MWG2031 Xmwg2031 MWG2031-7H
Type	Genomic STS
STS primers	5' AACGCTCTGTGTTTCCAGACC 5' TGCAGTATGAGTTGCCAGC
STS size	ca. 1200
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	AJ234722 AJ234721 MWG2031 MWG2031-5 MWG2031-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare