Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG2033

[Submit comment/correction]

Locus	MWG2033
Type	RFLP STS
Chromosome	4H
Chromosome Arm	4HS
Map	Barley-Consensus-4H -32.7 [ Show all 8 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 8 ]
Species	Hordeum vulgare Hordeum vulgare subsp. spontaneum
Probe	MWG2033
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	MWG2033-4H Xmwg2033-2A Xmwg2033-4A Xmwg2033a-4R Xmwg2033b-5R
Probe	MWG2033
Locus	MWG2033 [ Show all 6 ]
Type	Genomic STS
STS primers	5' GGCTGTTGACCCAGTAAAAT 5' CAACATAGCTGTACCGTGTA
STS size	231
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234724 AJ234723 MWG2033 MWG2033-5 MWG2033-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare