Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG2077

[Submit comment/correction]

Locus	MWG2077
Type	RFLP STS
Chromosome	1H 5H
Chromosome Arm	1HL
Map	Barley-Consensus-1H 23.4 [ Show all 12 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 12 ]
Species	Hordeum vulgare Hordeum vulgare subsp. spontaneum
Probe	MWG2077
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117. Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318.
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	Xmwg2077 Xmwg2077-1R
Probe	MWG2077
Locus	MWG2077 Xmwg2077 Xmwg2077-1R
Synonym	Synonym HAR35_39412
Type	Genomic STS
STS primers	5' CTGGTTAGAGTTTCCAGCCCAACCAT 5' GGGAAGATTGATGTTTCCCCTGCATA
STS size	234
Amplification Conditions	STS annealing temperature 60-62 oC
Sequence	AJ234759 AJ234758 MWG2077 MWG2077-5 MWG2077-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare