Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG2193

[Submit comment/correction]

Locus	MWG2193
Type	RFLP STS
Chromosome	5H
Map	Hordeum-AxK-5H 129.7 Hordeum-Bins-5H 180 Hordeum-Graner2-5H 199.3 Hv-Consensus2006-Marcel-5H 161 Hv-Integrated2009-5H 158
	[ Show Nearby Loci ]
Map Data	Barley, AxK Barley, BinMap 2005 Barley, Consensus 2006, Marcel Barley, Integrated, Marcel 2009 Barley, IxF
Probe	MWG2193
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = L9Oregon Wolfe Barleys x Vada,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Probe	MWG2193
Locus	MWG2193 RI014A23
Synonym	Synonym HAR35_9871
STS primers	5' CAAACCCTTGAGGTCAGTTGC 5' TCAGCTCTAAGATGCAGCACG
STS size	462
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234829 AJ234828 MWG2193 MWG2193-5 MWG2193-3
Source Species	Hordeum vulgare