Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG2196

[Submit comment/correction]

Locus	MWG2196
Type	RFLP
Chromosome	6H
Map	Barley-ConsensusFHB-6H 109.99 [ Show all 6 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	MetaQ.DON_6H_6
Map Data	Barley, BinMap 2005 [ Show all 6 ]
Probe	MWG2196
Reference	Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318.
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Probe	MWG2196
Locus	MWG2196
STS primers	5' TCCGCAAGACCTACGAAGCG 5' TCTTCTTCCCTTCTCCCGCC
STS size	174
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234831 AJ234830 MWG2196-5 MWG2196-3