Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG2224

[Submit comment/correction]

Locus	MWG2224
Type	RFLP
Chromosome	4H
Map	Hordeum-Bins-4H 58 Hordeum-Bins-5H 141 Hordeum-Graner2-4H 64 Hv-Consensus2006-Marcel-4H 61.16 Hv-Integrated2009-4H 72.6
	[ Show Nearby Loci ]
Map Data	Barley, BinMap 2005 Barley, Consensus 2006, Marcel Barley, Integrated, Marcel 2009 Barley, IxF
Probe	MWG2224
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Probe	MWG2224
Locus	MWG2224
Synonym	Synonym HAR35_15411 HAR35_15412
STS primers	5' AGCGCCGGAGAATAGGAGGC 5' CACCAGAGTCCACCACGAAGC
STS size	135
Amplification Conditions	STS annealing temperature 62-65 oC
Sequence	AJ234846 MWG2224-5